ID: 1093741766_1093741774

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1093741766 1093741774
Species Human (GRCh38) Human (GRCh38)
Location 12:22697054-22697076 12:22697096-22697118
Sequence CCATCTTTCTGCTTCGTCAGCTG CTGTCTCAGTGCAGCGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 324} {0: 1, 1: 0, 2: 1, 3: 10, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!