ID: 1093887293_1093887296

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1093887293 1093887296
Species Human (GRCh38) Human (GRCh38)
Location 12:24476703-24476725 12:24476736-24476758
Sequence CCATTAGAGTGGGAGTTCCTTGA AGTGTTTATTCACCTCTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 366} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!