ID: 1093909395_1093909400

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1093909395 1093909400
Species Human (GRCh38) Human (GRCh38)
Location 12:24728591-24728613 12:24728625-24728647
Sequence CCATCCTCAATATCTCTCTACAG AATTACAGATTAAGAAACTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 102, 3: 1193, 4: 5640}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!