ID: 1093925340_1093925344

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1093925340 1093925344
Species Human (GRCh38) Human (GRCh38)
Location 12:24903335-24903357 12:24903357-24903379
Sequence CCTCTAGGTGAATGGCCGGGAAG GCGCCCCTCGGTCAAGGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70} {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!