ID: 1093925345_1093925349

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1093925345 1093925349
Species Human (GRCh38) Human (GRCh38)
Location 12:24903360-24903382 12:24903381-24903403
Sequence CCCCTCGGTCAAGGCTAAGGAAA AACCTCGGAGAAACTACATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111} {0: 1, 1: 0, 2: 1, 3: 7, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!