ID: 1093930406_1093930412

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1093930406 1093930412
Species Human (GRCh38) Human (GRCh38)
Location 12:24949893-24949915 12:24949927-24949949
Sequence CCAAGTCTTTGCTGTGGAAGTTG CTCAAACAGAACTGGGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 222} {0: 1, 1: 0, 2: 1, 3: 19, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!