ID: 1093931140_1093931153

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1093931140 1093931153
Species Human (GRCh38) Human (GRCh38)
Location 12:24956099-24956121 12:24956151-24956173
Sequence CCCGCCCCGGGGAGCTGGGATTA TTGTATTTTTAGTAGAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 85, 4: 508} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!