ID: 1093977399_1093977411

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1093977399 1093977411
Species Human (GRCh38) Human (GRCh38)
Location 12:25438306-25438328 12:25438355-25438377
Sequence CCTTCCAGTTCCCCGCCTGCACA ATTTATATATATTTTCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 202} {0: 1, 1: 1, 2: 8, 3: 93, 4: 966}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!