ID: 1093996118_1093996121

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1093996118 1093996121
Species Human (GRCh38) Human (GRCh38)
Location 12:25644704-25644726 12:25644739-25644761
Sequence CCATAGATGCTGCAGAATAGAAG AAGAACAAGAATCCTTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163} {0: 1, 1: 0, 2: 2, 3: 20, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!