ID: 1093996118_1093996127

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1093996118 1093996127
Species Human (GRCh38) Human (GRCh38)
Location 12:25644704-25644726 12:25644753-25644775
Sequence CCATAGATGCTGCAGAATAGAAG TTGGAAAGGTGAGGGTGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163} {0: 1, 1: 0, 2: 4, 3: 64, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!