ID: 1094008640_1094008649

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1094008640 1094008649
Species Human (GRCh38) Human (GRCh38)
Location 12:25783107-25783129 12:25783153-25783175
Sequence CCTGCAGGTTTCCTCCTGGTCAC ATGAGATGAGGTGAAAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 243} {0: 1, 1: 0, 2: 3, 3: 66, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!