ID: 1094025832_1094025843

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1094025832 1094025843
Species Human (GRCh38) Human (GRCh38)
Location 12:25958942-25958964 12:25958974-25958996
Sequence CCGGGAGGTGCGCGGAGAGGGAA GCCGGGGCCTCCAGCCGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 256} {0: 1, 1: 1, 2: 1, 3: 11, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!