ID: 1094030845_1094030847

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1094030845 1094030847
Species Human (GRCh38) Human (GRCh38)
Location 12:26010015-26010037 12:26010034-26010056
Sequence CCTGGAGTGAGGGTGAGGGGGTG GGTGGCATCCTGATGCCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 615} {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!