ID: 1094034061_1094034071

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1094034061 1094034071
Species Human (GRCh38) Human (GRCh38)
Location 12:26048045-26048067 12:26048081-26048103
Sequence CCTCCAAGTTTTTATTCCTGGCC ATTTGGGTAGGCTGTAGTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 205} {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!