ID: 1094034061_1094034073

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1094034061 1094034073
Species Human (GRCh38) Human (GRCh38)
Location 12:26048045-26048067 12:26048096-26048118
Sequence CCTCCAAGTTTTTATTCCTGGCC AGTACTGGAAACTATGTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 205} {0: 1, 1: 0, 2: 23, 3: 70, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!