ID: 1094041181_1094041188

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1094041181 1094041188
Species Human (GRCh38) Human (GRCh38)
Location 12:26122891-26122913 12:26122906-26122928
Sequence CCCCGCGCGCTCCAGGCAGGGGG GCAGGGGGCGGCCGCGGACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 124} {0: 1, 1: 0, 2: 1, 3: 47, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!