ID: 1094041817_1094041823

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1094041817 1094041823
Species Human (GRCh38) Human (GRCh38)
Location 12:26126549-26126571 12:26126564-26126586
Sequence CCGGGGACGGATCTGGGTCGCGG GGTCGCGGGAAGCGGCGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 71} {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!