ID: 1094051670_1094051675

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1094051670 1094051675
Species Human (GRCh38) Human (GRCh38)
Location 12:26226984-26227006 12:26227000-26227022
Sequence CCGGGGCCACCGCGCCTCCGCCC TCCGCCCGCTGCGCAGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 586} {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!