ID: 1094054313_1094054318

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1094054313 1094054318
Species Human (GRCh38) Human (GRCh38)
Location 12:26253355-26253377 12:26253368-26253390
Sequence CCCCACCTCATCATTTCCTCACC TTTCCTCACCAGGAGATCTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 77, 4: 864} {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!