|
Left Crispr |
Right Crispr |
| Crispr ID |
1094078563 |
1094078575 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:26506383-26506405
|
12:26506433-26506455
|
| Sequence |
CCTGTGGTCCCAACTACTAGGAG |
GGGAAATCAAGGCTGCAGTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 19, 2: 333, 3: 3582, 4: 25741} |
{0: 3, 1: 14, 2: 111, 3: 328, 4: 898} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|