ID: 1094096135_1094096137

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1094096135 1094096137
Species Human (GRCh38) Human (GRCh38)
Location 12:26706863-26706885 12:26706885-26706907
Sequence CCTTGGGCTGGGCCTCAGTTTTA AATATTGTCTATGTATGATTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 272} {0: 1, 1: 0, 2: 1, 3: 25, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!