ID: 1094162333_1094162337

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1094162333 1094162337
Species Human (GRCh38) Human (GRCh38)
Location 12:27404842-27404864 12:27404856-27404878
Sequence CCTTTCCTAGTCAAAGGGGTGAC AGGGGTGACAGATGGGCACCTGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 2, 3: 10, 4: 79} {0: 1, 1: 0, 2: 0, 3: 34, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!