ID: 1094188918_1094188924

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1094188918 1094188924
Species Human (GRCh38) Human (GRCh38)
Location 12:27676939-27676961 12:27676956-27676978
Sequence CCGCATGCCTCTCCTCCACGGTG ACGGTGTGTATTTGGCGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 255} {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!