ID: 1094190655_1094190656

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1094190655 1094190656
Species Human (GRCh38) Human (GRCh38)
Location 12:27694985-27695007 12:27695004-27695026
Sequence CCATTCATTATGTGGTAACTGTA TGTATTGAACTTACTTTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 166} {0: 1, 1: 0, 2: 1, 3: 15, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!