ID: 1094199171_1094199187

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1094199171 1094199187
Species Human (GRCh38) Human (GRCh38)
Location 12:27779948-27779970 12:27779986-27780008
Sequence CCAGCCGGCAGGTCAGGCCGGCG GCGGAAGTGAGAAGGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121} {0: 1, 1: 0, 2: 1, 3: 26, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!