ID: 1094201377_1094201387

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1094201377 1094201387
Species Human (GRCh38) Human (GRCh38)
Location 12:27797898-27797920 12:27797942-27797964
Sequence CCGTGCAGTCCTACAACACCGTC AAGGAGAACACGTCCAAATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72} {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!