ID: 1094209035_1094209037 |
View in Genome Browser |
Spacer: -10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1094209035 | 1094209037 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:27870926-27870948 | 12:27870939-27870961 |
| Sequence | CCTTCAATATCCTGGACAATATA | GGACAATATAATTATCCACATGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||