ID: 1094211925_1094211932

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1094211925 1094211932
Species Human (GRCh38) Human (GRCh38)
Location 12:27902025-27902047 12:27902073-27902095
Sequence CCCAGTTATGAAGTTGACACATG ATGGCTTTGGTAGTCCACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!