ID: 1094221621_1094221623

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1094221621 1094221623
Species Human (GRCh38) Human (GRCh38)
Location 12:28000050-28000072 12:28000080-28000102
Sequence CCTCTGACCAGCTGCATGCAGGC GCAATACCACTTTTAAACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!