|
Left Crispr |
Right Crispr |
| Crispr ID |
1094319669 |
1094319676 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:29171403-29171425
|
12:29171441-29171463
|
| Sequence |
CCCGGCTGCTGCCCCATCTGGGA |
TGCCCAGCTGCCACCCCATCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357} |
{0: 10, 1: 112, 2: 692, 3: 2679, 4: 3840} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|