ID: 1094345821_1094345830

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1094345821 1094345830
Species Human (GRCh38) Human (GRCh38)
Location 12:29467760-29467782 12:29467811-29467833
Sequence CCTAAGTGTGGAACACCACCATC TAAAGAATCAGAAGCTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101} {0: 1, 1: 0, 2: 2, 3: 25, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!