ID: 1094361202_1094361213

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1094361202 1094361213
Species Human (GRCh38) Human (GRCh38)
Location 12:29633216-29633238 12:29633262-29633284
Sequence CCGCATGTCCCATATGGTCTCTA CAGTCATAGCACAGGGTCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 131} {0: 1, 1: 0, 2: 1, 3: 13, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!