ID: 1094361791_1094361802

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1094361791 1094361802
Species Human (GRCh38) Human (GRCh38)
Location 12:29638775-29638797 12:29638808-29638830
Sequence CCCCATCACACACCCTGCCAGGG ACTCCTCCCGTTTCACCACTAGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 55, 3: 137, 4: 487} {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!