ID: 1094375292_1094375301

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1094375292 1094375301
Species Human (GRCh38) Human (GRCh38)
Location 12:29783301-29783323 12:29783320-29783342
Sequence CCATGCACATCCTGGAGAGGAGG GAGGGAGGCGTGGAGGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 327} {0: 1, 1: 1, 2: 6, 3: 196, 4: 1625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!