ID: 1094457841_1094457843

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1094457841 1094457843
Species Human (GRCh38) Human (GRCh38)
Location 12:30658772-30658794 12:30658821-30658843
Sequence CCATTTAGTTTCAATACAGAAGG AAATAAAAATTAAGCCCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163} {0: 1, 1: 0, 2: 4, 3: 81, 4: 773}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!