|
Left Crispr |
Right Crispr |
| Crispr ID |
1094462555 |
1094462564 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:30712891-30712913
|
12:30712935-30712957
|
| Sequence |
CCACCACGTCCGGCTAATTTTGA |
CACCCTGTTGGTGGTCAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 188, 2: 5625, 3: 55892, 4: 181382} |
{0: 1, 1: 3, 2: 11, 3: 57, 4: 284} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|