ID: 1094493653_1094493660

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1094493653 1094493660
Species Human (GRCh38) Human (GRCh38)
Location 12:30976517-30976539 12:30976566-30976588
Sequence CCACAGACGCTCTCTTCAGCCTC TCAGTACCACACGCAGACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 313} {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!