ID: 1094495063_1094495070

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1094495063 1094495070
Species Human (GRCh38) Human (GRCh38)
Location 12:30984081-30984103 12:30984120-30984142
Sequence CCTCAGCGGCAAGGGCCCCTGCA CACGCCTGCTTCCGCTCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179} {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!