ID: 1094503067_1094503070

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1094503067 1094503070
Species Human (GRCh38) Human (GRCh38)
Location 12:31037405-31037427 12:31037431-31037453
Sequence CCCACAGCAGAGGTGGCTGAGAT CACCTTCTCCTGCTCCTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 84, 4: 660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!