ID: 1094512244_1094512252

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1094512244 1094512252
Species Human (GRCh38) Human (GRCh38)
Location 12:31103620-31103642 12:31103644-31103666
Sequence CCTGGACCAGCGATATGCCCGGC CCCTGTCCTGGCCAAGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 7, 4: 43} {0: 3, 1: 1, 2: 4, 3: 33, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!