ID: 1094524321_1094524333

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1094524321 1094524333
Species Human (GRCh38) Human (GRCh38)
Location 12:31221680-31221702 12:31221732-31221754
Sequence CCCTCAAGAGGCACAGCCTGAGG GGTTGCTTGCGGCCAAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!