|
Left Crispr |
Right Crispr |
| Crispr ID |
1094560450 |
1094560456 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:31547963-31547985
|
12:31548001-31548023
|
| Sequence |
CCCAAAGTGCTGGGACTGAAGGT |
CAGCCTCTAAAAAGTTTTAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 110, 2: 3826, 3: 93972, 4: 339162} |
{0: 1, 1: 0, 2: 2, 3: 30, 4: 323} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|