ID: 1094564923_1094564926

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1094564923 1094564926
Species Human (GRCh38) Human (GRCh38)
Location 12:31590802-31590824 12:31590815-31590837
Sequence CCGGGCCGGGCGCCGCGCAGCTC CGCGCAGCTCCCGCTCATCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 301} {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!