ID: 1094564938_1094564948

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1094564938 1094564948
Species Human (GRCh38) Human (GRCh38)
Location 12:31590855-31590877 12:31590888-31590910
Sequence CCGCCGCCGCCGCCGCCCGGGAA GGAGGCTGCCACCACCGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 67, 3: 303, 4: 1216} {0: 1, 1: 0, 2: 4, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!