ID: 1094567781_1094567785

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1094567781 1094567785
Species Human (GRCh38) Human (GRCh38)
Location 12:31615959-31615981 12:31615994-31616016
Sequence CCTCCTGCTGGACTAATGGTTCA TCAATACCATGTACATGAGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 0, 3: 3, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!