ID: 1094682224_1094682225

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1094682224 1094682225
Species Human (GRCh38) Human (GRCh38)
Location 12:32677021-32677043 12:32677038-32677060
Sequence CCACTGGAGTTGCGTAGTGCACA TGCACAACTTCCACTACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 64, 4: 175} {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!