ID: 1094687969_1094687974

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1094687969 1094687974
Species Human (GRCh38) Human (GRCh38)
Location 12:32737912-32737934 12:32737965-32737987
Sequence CCCCGCTGCTTCTGCTGAGGCTG AGCCTGCATGCCTTGTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 548} {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!