ID: 1094708517_1094708519

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1094708517 1094708519
Species Human (GRCh38) Human (GRCh38)
Location 12:32938092-32938114 12:32938106-32938128
Sequence CCCTTGTGTTTGGAAAATATCTA AAATATCTACAGCTGCAGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!