ID: 1094714136_1094714144

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1094714136 1094714144
Species Human (GRCh38) Human (GRCh38)
Location 12:32994864-32994886 12:32994902-32994924
Sequence CCACCAGTTCCACAGATGACCAT GACCCACTTGGGAATCAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!