ID: 1094723540_1094723543

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1094723540 1094723543
Species Human (GRCh38) Human (GRCh38)
Location 12:33089545-33089567 12:33089565-33089587
Sequence CCAGTATTGACAGAGGGCTTATC ATCTGTAATACGGAGCTGGAAGG
Strand - +
Off-target summary No data {0: 4, 1: 11, 2: 24, 3: 14, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!